text in 
English (pdf)
Article in xml format
Article references
Automatic translation
Send this article by e-mail
Cited by SciELO 
Cited by Google 
Similars in
SciELO 
Similars in Google 
Permalink
Remark
| 1) Why was this study conducted? |
| The present study was done to explore the association of SNP C/T7673 with dyslipidemia and overweight/obesity in a sample of the Colombian Caribbean population. The development of this study contributed to the field of potential biomarkers of risk of cardiovascular disease (CVD) in the Colombian population. |
| 2) What were the most relevant results of the study? |
| The distribution of SNP C/T7673 is in Hardy-Weinberg equilibrium in the studied population and the genotypic frequencies are similar to those reported by studies conducted in other Colombian populations and Latin American countries. Finally, it is suggested that the SNP C/T7673 does not influence the lipid profile and BMI in the studied population. |
| 3) What do these results contribute? |
| In Colombia, there are few studies on the possible association of polymorphism C/T7673 with dyslipidemias and overweight/obesity. These results contribute to new knowledge of biomarkers to identify the risk of CVD. |
Introduction
Cardiovascular diseases (CVD) are recognized as the leading cause of death worldwide; with a percentage of 30%, equal to that reported for Colombia 1,2. Obesity and dyslipidemia are some of the main CVD risk factors 3-5, the respective indicators are the Body Mass Index (BMI) and lipid profile. The determination of these indicators is important for the prevention, diagnosis and monitoring of cardiovascular disease in an individual 6-8.
Lipid profile comprises determining triglycerides (TG), total cholesterol (TC), cholesterol linked to low density lipoproteins (LDL-C,Low Density Lipoprotein-Cholesterol) and cholesterol linked to High Density Lipoprotein (HDL-C,High Density Lipoprotein-Cholesterol)7,8. The protein component (apoprotein) plays a pivotal role in the structure and function of the lipoproteins; therefore, variations in the gene encoding the apoprotein can cause structural or functional effects 9-10. Apolipoprotein B (ApoB) is the main protein component of LDL, VLDL (Very Low Density Lipoprotein) and chylomicrons 11. ApoB is essential for the assembly and secretion of VLDL in the liver and has the domain to bind LDL to its receptor; therefore, it is the key for the transport and metabolism of lipids 12,13. ApoB is encoded by a gene of 43 kpb located on the short arm of chromosome 2 (2p24) and comprises 29 exons and 28 introns 14,15. This gene is polymorphic 16,17 and some polymorphisms are related to dyslipidemia 18-21.
One of the most studied polymorphisms has been the single nucleotide polymorphism (SNP) rs693,also called XbaI and C/T767322. It is located in exon 26 of the apoB gene at codon 2488 and results from the substitution of cytosine by thymine at the third position (ACC → ACT), creating a silent mutation, as both codons encoding threonine. The presence of thymine generates the restriction site and gives the name to the resulting T allele, also known as X+ allele. However, in the absence of T allele, it is identified as C or X- allele 23.
Although the SNP rs693 does not imply change in the amino acid sequence of the protein, it is associated with dyslipidemia, obesity and cardio-cerebrovascular diseases in populations from Brazil 23, China 24and European countries 25. The association would favor the possibility of using the SNP rs693 as a predictor of risk of these diseases in the indicated populations 23. However, in other populations, very low association has been found, for example, in Northern India 26.
The genotypic and allelic distributions of rs693 in the Colombian population are not completely known. Historically, this population has been regarded as the mixture of three main ethnicities: Africans, Amerindians, and Caucasians 27,28. In Andean population from Armenia-Colombia, Loango et al. 29, evaluated the association between this polymorphism with plasmatic lipids in children and their parents. However, the admixture between the three ethnicities has different extent in each region of Colombia. This is why, the study of rs693 in a sample of Colombian Caribbean population is justified 28. Furthermore, because clinical implications of the polymorphism rs693 on the cardiovascular risk factors are not universal, it is important to explore this variant in different populations 25. The present study aims to determine the association of apoB rs693 polymorphism with the lipid profile and BMI in a sample of the Colombian Caribbean population.
Materials and Methods
Study group
This analytical cross-sectional study was performed from an initial group of 331 unrelated adult subjects, both gender, different ages and schooling and born in the Colombian Caribbean like their ancestors to the third degree of consanguinity. After applying a questionnaire and performing a medical interview at Universidad Libre from Barranquilla, smokers, vegetarians, pregnant women, diabetics and all those who were or had been under pharmacological treatment for cardio-cerebrovascular disease, dyslipidemia, hypertension, cancer, liver disease, endocrine disorders or kidney disease were excluded. Thus, the initial group was reduced to 108 subjects (mean age 52 ±11 years), 34 men (31.5%) and 74 women (68.5%).
The study was approved by the local ethics committee at Universidad Libre from Barranquilla and informed written consent was obtained from all study subjects before their participation.
Anthropometric measurements and lipid profile
Anthropometric measurements included the recording of weight and height by standard methods. Body Mass Index (BMI) was determined according to the traditional formula of Quetelet: weight in kilograms divided by the square of the height (Kg/m2). The criteria of the clinical guidelines of the NIH-USA were taken into account to classify the subjects according to the BMI into two categories: normal weight (values range from 18.5 to 24.99 Kg/m2) and overweight/obesity (values ≥ 25 Kg/m2) 8.
For biochemical studies, a blood sample was drawn by venipuncture from an antecubital vein, following an overnight fast, from each subject under study. Serum was collected from all samples after centrifugation at room temperature. Serum levels of total cholesterol (TC), triglycerides (TGC), HDL cholesterol (HDL-C) and LDL cholesterol (LDL-C) were determined by using COBAS C501 equipment (Roche®, Switzerland), following the manufacturer’s instructions.
Genotyping of the SNP rs693
The genomic DNAs of all the subjects were extracted from 600 µL of whole blood with Wizard® Genomic Kit (Promega®, USA) following the manufacturer’s instructions. The genotyping of the SNP rs693 was done by Polymerase Chain Reaction (PCR) followed by digestion with restriction enzyme XbaI. The DNA fragment containing the SNP rs693 was amplified using a sense primer (5 'GGAGACTATTCAGAAGCTAA 3') and an antisense primer (5 'GAAGAGCCTGAAGACTGACT 3'). The PCR reaction was performed in a PTC-100 (MJ Research®,Canada) thermocycler, in a final volume of 25 µL containing 25 mM of each primer, 5 µL of DNA and master mix MangoMix (Bioline®, England) which provided MgCl22.5 mM and 200 mM dNTPs. The PCR conditions consisted of an initial denaturation step at 95° C for 10 min, followed by 30 cycles of denaturation at 95° C for 1 min, annealing at 49° C for 1 min, and extension at 72° C for 1 min, with a final elongation at 72° C for 8 min. The PCR product was a 710 bp band which was digested with the enzyme XbaI (New England Biolabs®,USA) following the instructions of the enzyme manufacturer. The digestion products were then visualized by gel electrophoresis with polyacrylamide 8% and staining with ethidium bromide. When the T allele was present in the restriction site, two bands (433 bp and 277 bp) were obtained. If after the digestion a single band of 710 bp was obtained it was interpreted as CC genotype; if three bands (433 bp, 710 bp and 277pb) were obtained it was interpreted as CT genotype,and if two bands (433 bp and 277 bp) were obtained it was interpreted as TT genotype.
Quality control
The quality of the biochemical tests was verified using commercial serum, normal and abnormal controls (Roche, Switzerland). Reagent controls were used in each amplification to monitor contamination in the molecular analysis. Genotyping was confirmed by repeating at random 40% of the analyzes performed.
Statistical analysis
The Statistical Package for Social Studies SPSS version 20.0 was used to conduct all data analyses. The total population was grouped according to the values of the lipid profile (subjects with normal and abnormal levels) and the BMI (normal weight and overweight/obese). The data obtained are presented as mean ± SD or percentages. Student’s t-test was used to compare means and Chi-square test was applied to compare proportions.
The genotype frequencies and the Hardy-Weinberg were determined with Arlequin version 3.11 software 30. The data were further grouped according to the three genotypes of the SNP rs693. The chi-square test was used to analyze the distribution of the rs693 genotype and the genotype-phenotype association was evaluated through different inheritance models: co-dominant, dominant, recessive and additive. A value of p <0.05 was considered statistically significant.
Results
Anthropometric characteristics and lipid profile
The anthropometric characteristics and the lipid profile of the study subjects classified by gender are presented in Table 1. When comparing means with Student’s t-test, there was statistically significant difference between the average weight (p= 0.007) and height (p= 0.008) between men and women; but not difference was found between the mean age (p= 0.06). The average body mass index (n= 108) was 26.21 ±3.72 Kg/m2and no statistically significant difference was found between the average BMI of women (25.74 ±3.50 Kg/m2) and men (27.25 ±4.00 Kg/m2), (p= 0.3435).
Table 1 Anthropometric characteristics and lipid profile of the subjects under study.
| Variable | Gender | (n=108) Mean ± SD | |
|---|---|---|---|
| Female (n=74) Mean ± SD | Male (n=34) Mean ± SD | ||
| Age (year) | 53 ± 10 | 50 ± 11 | 52±11 |
| Height (m) | 1.61 ± 0.07 | 1.71 ± 0,07 | 1.64 ± 0.08 |
| Weight (kg) | 66.71 ± 9.51 | 79.97 ± 13.54 | 70.89 ± 12.51 |
| Total cholesterol (mg/dL) | 190.35 ± 40.74 | 178 ± 25.86 | 186.46 ± 37.04 |
| High Density Lipoprotein-Cholesterol (mg/dL) | 47.16 ± 12.02 | 42.85 ± 9.66 | 45.81 ± 11.47 |
| Low Density Lipoprotein-Cholesterol (mg/dL) | 119.09 ± 34.98 | 117.88 ± 23.12 | 118.71 ± 31.62 |
| Triglycerides (mg/dL) | 158.91 ± 128.72 | 131.74 ± 58.76 | 150.35 ± 111.94 |
| Body mass index (Kg/m2) | 25.74 ± 3.50 | 27.25 ± 4.00 | 26.21 ± 3.72 |
Total cholesterol in men) ≥170; in women) ≥180
Triglycerides ≥150;
High Density Lipoprotein-Cholesterol in men ˂40; in women ˂50
Low Density Lipoprotein-Cholesterol ≥100 were considered abnormal values.
With regard to the lipid profile, the averages of the parameters evaluated in all individuals are presented in Table 1. The subjects were grouped according to National Lipid Association recommendations 7. After using Chi-square test, significant differences were not found between men and women when comparing the corresponding frequencies for each parameter of the lipid profile (p >0.05) (Table 2).
Table 2 Frequency of abnormal body mass index and lipid profile with respect to the gender.
| Variables | Gender | |
|---|---|---|
| Female n=74 (%) | Male n=34 (%) | |
| Body mass index | 40 (54.1) | 23 (67.6) |
| Triglycerides | 26 (35.1) | 8 (23.5) |
| Total Cholesterol | 44 (59.5) | 23 (67.6) |
| High Density Lipoprotein-Cholesterol | 38 (51.4) | 18 (52.9) |
| Low Density Lipoprotein-Cholesterol | 53 (71.6) | 27 (79.4) |
Genotype and allele frequencies of SNP rs693.
Of the 108 genotyped subjects, 49 (45.0%) presented CC genotype; 41 (38.5%) presented CT genotype and the remaining 18 (16.5%) presented TT genotype. These data show that the C allele was majority; in fact, the allele frequencies were 139 (64.0%) for C allele and 77 (36.0%) for the T allele.The distribution of the genotype frequencies was in Hardy-Weinberg equilibrium (p >0.05). Genotype and allele frequencies were compared with other Latin American populations (Table 3).
Table 3 Comparison of the genotypic and allelic frequencies in the present study with other Latin American populations.
| Genotype | Colombian Caribbeans (present study) n= 108 | Brazilian population 23 n= 192 | Mexican population 31 n=246 | Colombian Andeans from Armenia 29 n= 148 |
|---|---|---|---|---|
| CC7673 | 45.0% | 33% | 47% | 28%* |
| CT 7673 | 38.5% | 50% | 38% | 65%* |
| TT 7673 | 16.5% | 17% | 15% | 7% |
| Alleles | ||||
| C 7673 | 65% | 58% | 66% | 61% |
| T 7673 | 35% | 42% | 34% | 39% |
*p <0.05 compared to Caribbeans-Colombia (present study).
Genotype frequencies regarding lipid profile and BMI
The genotype frequencies with respect to lipid profile and BMI are shown in table 4. None of the inheritance models showed a significant increase in the odds of alterations in BMI or lipid profile parameters (Table 4). There were also no significant differences in these outcomes when gender and age variables were included in these models.
Table 4 Analysis of the association between the genotype and alterations in the lipid profile and BMI, depending on the inheritance model. Data are presented as frequencies and percentages of subjects with abnormal values*
| Variable (N=108) | Model | Genotype | n | % | OR | CI (95%) |
|---|---|---|---|---|---|---|
| Body Mass Index (n=63) | co-dominant | CC 7673 | 26 | 41.3 | 1 | |
| CT7673 | 26 | 41.3 | 0.712 | 0.321-1.579 | ||
| TT7673 | 11 | 17.5 | 0.871 | 0.309-2.453 | ||
| dominant | CC 7673 | 26 | 41.3 | 1 | ||
| CT7673/ TT7673 | 37 | 58.7 | 0.672 | 0.311-1.452 | ||
| Recessive | CC7673/ CT7673 | 52 | 82.5 | 1 | ||
| TT7673 | 11 | 17.5 | 0.871 | 0.309-2.453 | ||
| additive | 0.719 | 0.239-2.164 | ||||
| Triglycerides (n=34) | co-dominant | CC 7673 | 13 | 38.2 | 1 | |
| CT7673 | 16 | 47.1 | 0.574 | 0.251-1.314 | ||
| TT7673 | 5 | 14.7 | 1.236 | 0.402-3.797 | ||
| dominant | CC 7673 | 13 | 38.2 | 1 | ||
| CT7673/ TT7673 | 21 | 61.8 | 0.653 | 0.285-1.496 | ||
| recessive | CC7673/ CT7673 | 29 | 85.3 | |||
| TT7673 | 5 | 14.7 | 1.236 | 0.402-3.797 | ||
| additive | 0.939 | 0.280-3.151 | ||||
| Total Cholesterol (n=67) | co-dominant | CC 7673 | 30 | 44.8 | 1 | |
| CT7673 | 29 | 43.3 | 0.542 | 0.237-1.241 | ||
| TT7673 | 8 | 11.9 | 2.379 | 0.852-6.639 | ||
| dominant | CC 7673 | 30 | 44.8 | 1 | ||
| CT7673/ TT7673 | 37 | 55.2 | 0.939 | 0.430-2.048 | ||
| recessive | CC7673/ CT7673 | 59 | 88.1 | 1 | ||
| TT7673 | 8 | 11.9 | 2.379 | 0.852-6.639 | ||
| additive | 1.974 | 0.662-5.888 | ||||
| High Density Lipoprotein-Cholesterol (n=56) | co-dominant | CC 7673 | 25 | 44.6 | 1 | |
| CT7673 | 24 | 42.9 | 0.648 | 0.295-1.419 | ||
| TT7673 | 7 | 12.5 | 1.878 | 0.667-5.284 | ||
| dominant | CC 7673 | 25 | 44.6 | 1 | ||
| CT7673/ TT7673 | 31 | 55.4 | 0.941 | 0.441-2.008 | ||
| recessive | CC7673/ CT7673 | 49 | 87.5 | 1 | ||
| TT7673 | 7 | 12.5 | 1.878 | 0.667-5.284 | ||
| additive | 1.637 | 0.544-4.921 | ||||
| Low Density Lipoprotein-Cholesterol (n=80) | co-dominant | CC 7673 | 33 | 41.3 | 1 | |
| CT7673 | 34 | 42.5 | 0.451 | 0.172-1.182 | ||
| TT7673 | 13 | 16.3 | 1.12 | 0.360-3.486 | ||
| dominant | CC 7673 | 33 | 41.3 | 1 | ||
| CT7673/ TT7673 | 47 | 58.8 | 0.527 | 0.220-1.258 | ||
| recessive | CC7673/ CT7673 | 67 | 83.8 | 1 | ||
| TT7673 | 13 | 16.3 | 1.12 | 0.360-3.486 | ||
| additive | 0.793 | 0.241-2.612 |
* No association of the single nucleotide polymorphism rs693 with lipid profile nor the body mass index was found (p >0.05).
Discussion
Polymorphisms in genes associated with dyslipidemia or obesity may be genetic predictors of CVD in populations where the association is obvious 21-24. In this study, the genotypic and allelic frequencies were determined for the SNP rs693 such as its relationship with lipid profile and BMI in a sample of the Colombian Caribbean population, a product of the ancestral mixture of African black, Amerindian and European white 28.
Genotypic analysis of polymorphism revealed: first, that in the sample studied the distribution of genotypes was not significantly different from the expected distribution for a population in Hardy-Weinberg equilibrium; second, that all possible genotypes for rs693 (TT, TC and CC) were present; and third, that the TT genotype was minority. Furthermore, the allelic analysis revealed that C was majority (64%) versus T (36%).
The T allele frequency found in this study is in agreement with those reported in a sample of mestizo Colombian Andean population from Armenia-Colombia 29, in a sample of Brazilian people 23, and in a sample of Mexican people 31. However, there are notable differences with respect to the allelic frequencies found in European, Asian and African populations. In European populations, the frequency of T allele is higher (~53%) (32-35), except Norwegians (~27%) 32, while it is lower in Asians (~12%) 36-39 and Africans (~21%) 40-42.
Distribution of genotypes in Colombian Caribbeans differed from that of Colombian Andeans from Armenia 29. The frequencies of CT and CC were higher in Colombian Andeans and a significant difference was found when the genotype distribution was compared between these two populations. However, no significant differences in genotype frequencies were observed when comparing Colombian Caribbeans to other Latin American populations (Brazilians and Mexicans) 23,31 (Table 3). This phenomenon is typical in Colombian population and is the product of historical events that gave rise to it 43. The admixture between European, African, and Amerindian populations has a different extent in each region of Colombia. In central and Eastern Colombia, including Armenia, European and Amerindian ancestry predominate; in coastal regions, including Caribbean population in the present study, European, Amerindian and African ancestors all significantly contributed to this population 44.
On the other hand, in the sample studied, the SNP rs693 does not appears to influence plasma lipid levels. Indeed, there was no significant association with the TT and CT genotypes,or the mutant allele T7673; p-value was always >0.05. This finding agrees with that reported in other Colombian study 29, when they did not find statistically significant differences (TC p= 0.47, HDL-C p= 0.23; LDL-C p= 0.40; TG p= 0.10). It is also in agreement with the findings in a sample of the Brazilian population 26, and in Indians 45; in these cases, in all comparisons p >0.05.
By contrast, our results differ from the findings in Egyptians 46, who reported association of the T allele with increased cholesterol levels (p= 0.041) and LDL-C (p= 0.021); in a population of Mongolia 38, when found significant association with triglyceride levels since these were significantly higher in men with genotype CT7673than in men with CC genotype (p= 0.047); in China 37 that CT genotype carriers tend to have high LDL levels, but low levels of HDL-C (p <0.05) and, finally, the results also in China 47, when reported that subjects with T allele exhibited,significantly higher levels of LDL-C, TC and TG, compared to subjects with C allele (p <0.05).
For BMI, our results showed no significant association with genotypes nor with the mutant T allele (p >0.05). This result agrees with that reported in Colombian mestizos 29, found no significant differences (p= 0.08) among subjects with T allele and subjects with C allele. Our study agrees with Egyptian subjects 46, who found no significant differences in BMI of with TT, CT and CC genotypes and the lack of association (p >0.05) 26. However, our result is discordant with the findings in China, who found significantly higher values (p <0.05) in subjects with T allele than in subjects with C allele 47.
In this study the genotype-phenotype association with respect to wild-type C allele (X-) was also studied. Unlike the findings about positive association of this allele with coronary artery disease and myocardial infarction 23,48, in this study no association (p >0.05) was found.
The similarity of our results with those of another study conducted in Colombia, in a far and different geographical area leads us to infer that the characteristic ancestral mixture of the two samples studied was the key factor to reproduce the result, despite environmental factors and lifestyle.
Environmental factors, however, can contribute to differences that are mainly due to ethnic variability. Indeed, biochemical phenotypes such as levels of plasma lipids, anthropometric parameters such as weight, demographic variables such as gender and age, environmental conditions such as food or cigarette smoking, and specific factors of the study as the sample size or the criteria for inclusion and exclusion, can influence the differences between the results of this study and others already referenced.
In this study, the wide age range of subjects, the differences in lifestyle and the sample size constituted limitations. However, the findings of this exploratory work should be validated in the future, with a study of a representative sample of the population of the Colombian Caribbean, under the case-control design.
